Review



proteome profiler mouse phospho rtk array kit r d systems cat  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    R&D Systems proteome profiler mouse phospho rtk array kit r d systems cat
    Proteome Profiler Mouse Phospho Rtk Array Kit R D Systems Cat, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 78 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/proteome+profiler+mouse+phospho+rtk+array+kit+r+d+systems+cat/Proteome+Profiler+Mouse+Phospho-RTK+Array+Kit/pm41762656-249-72-78
    Average 94 stars, based on 78 article reviews
    proteome profiler mouse phospho rtk array kit r d systems cat - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    other:

    Article Title: Therapeutic targeting of syndecan-1 axis overcomes acquired resistance to KRAS-targeted therapy in gastrointestinal cancers
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Proteome Profiler Human Phospho-RTK Array Kit R&D Systems Cat#ARY001B Proteome Profiler Mouse Phospho-RTK Array Kit R&D Systems Cat#ARY014 Annexin V-fluorescein isothiocyanate (FITC) apoptosis detection kit BioVision Cat#K101 Experimental models: Cell lines AsPC-1 ATCC RRID:CVCL_0152 HuP-T4 ATCC RRID:CVCL_1300 MIA PaCa-2 ATCC RRID:CVCL_0428

    Viability Assay:

    Article Title: Lipocalin 2 orchestrates resistance to ferroptosis via AXL.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GPX4 Cell Signaling Technology Cat #52455S; RRID:AB_2924984 Rabbit anti-pAXL (Y702) ThermoFisher Cat #PA5-64862; RRID:AB_2662770 Rabbit anti-AXL (C terminus) LS Bio Cat # LS-B12012-100 hFAB TM Rhodamine Anti-Actin Bio-Rad Cat #120041163 Goat anti-rabbit StarBright Blue 700 Bio-Rad Cat #12004161; RRID:AB_2721073 Rabbit anti-BCL-XL Cell Signaling Technology Cat #2764T; RRID:AB_2228008 Rabbit anti-BIM Cell Signaling Technology Cat #2819S; RRID:AB_10692515 Rabbit anti-BAK Cell Signaling Technology Cat #3814S; RRID:AB_2290287 Rabbit anti-lipocalin-2 antibody Abcam Cat #ab63929; RRID:AB_1140965 Chicken anti-GFP Aves Labs Cat #GFP-1020; RRID:AB_10000240 Mouse anti-Beta III Tubulin Promega Cat #G7121; RRID:AB_430874 Rabbit anti-Phosphorylated Histone H3 Cell Signaling Technology Cat #4499; RRID:AB_10544537 Rabbit anti-Cleaved Caspase 3 Cell Signaling Technology Cat #9661; RRID:AB_2341188 Bacterial and virus strains psPAX2 (lentiviral packaging plasmid) Addgene (Didier Trono) Cat #12260; RRID:Addgene_12260 pMD2.G (lentiviral packaging plasmid) Addgene (Didier Trono) Cat #12259; RRID:Addgene_12259 MISSION pLKO.1-puro Non-Mammalian shRNA Control Sigma TRC #SHC002 Lcn2 shRNA KD1 Sigma TRC #TRCN0000055328 Lcn2 shRNA KD2 Sigma TRC #TRCN0000055331 Lcn2 shRNA KD3 Sigma TRC #TRCN0000055332 Biological samples Human glioblastoma patient tissue This paper, Cleveland Clinic See STAR Methods Human non-tumor patient tissue This paper, Cleveland Clinic See STAR Methods Primary mouse astrocytes Silver et al. 80 See STAR Methods Chemicals, peptides, and recombinant proteins RPMI 1640 medium Cleveland Clinic Media Preparation Core N/A Fetal bovine serum Cleveland Clinic Media Preparation Core N/A Penicillin-Streptomycin Cleveland Clinic Media Preparation Core N/A Trypsin-EDTA Cleveland Clinic Media Preparation Core N/A Trypan Blue ThermoFisher Cat #15250061 Image-It Lipid Peroxidation Kit Invitrogen Cat #C10445 CellRox Deep Red ThermoFisher Cat #C10422 Deferoxamine (DFO) Sigma Cat #D9533-1G RSL3 (GPX4 inhibitor) SelleckChem Cat #S8155 Erastin SelleckChem Cat #S7242 Ferrostatin-1 (Fer-1) SelleckChem Cat #S7243 Liproxstatin-1 (Lip-1) SelleckChem Cat #S7699 Necrostatin-1 SelleckChem Cat #ab141053 Z-VAD-FMK InvivoGen Cat #tlrl-vad PAC-1 SelleckChem Cat #S2738 Bemcentinib (R428, BGB324) SelleckChem Cat #S2841 1x NP-40 lysis buffer ThermoFisher Cat #J60766.AP Protease inhibitor cocktail Sigma-Aldrich Cat #P8340 (Continued on next page) 16 Cell Reports 45, 116965, March 24, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Phosphatase inhibitor cocktail Sigma-Aldrich Cat #P5725 PMSF Sigma-Aldrich Cat #10837091001 Sodium acetate ThermoFisher Cat #A13184-30 Thioglycolic acid Fisher Scientific Cat #M0052252G Chromogenic solution (FerroZine) MedChemExpress Cat #HY-137805 FITC-annexin V BioLegend Cat #640914 DRAQ7 ThermoFisher Cat #D15105 Critical commercial assays CellTiter Glo Cell Viability Assay Promega Cat #G7573 RNeasy Mini Kit Qiagen Cat #74106 qScript cDNA SuperMix Quanta Biosciences Cat #95048-100 Fast SYBR Green Mastermix ThermoFisher Cat #4385618 Proteome Profiler Mouse Phospho-RTK Array Kit R&D Systems CatARY014 Experimental models: Cell lines OL61 (mouse glioma) Castro-Lowenstein Laboratory, Univ. .. Michigan See STAR Methods KR158 (mouse glioma) Deleyrolle Laboratory, Mayo Clinic See STAR Methods CPA (mouse glioma) Deleyrolle Laboratory, Mayo Clinic See STAR Methods Experimental models: Organisms/strains C57BL/6 JAX RRID:IMSR_JAX:000664 NOD.Cg-Prkdc scid Il2rg tm1Wjl /SzJ Biological Resources Unit, Lerner Research Institute; Cleveland Clinic – B6.129P2-Lcn2 tm1Aade /AkiJ KAX RRID:IMSR_JAX:024630 Oligonucleotides LCN2 Forward: AGCCGTGGTAGATGGCTAGG This paper See Table S1 LCN2 Reverse: TTCCGCGGGTGACAGGGCTTC This paper See Table S1 GAPDH Forward: AGGCTGGTGACGAGGATTTG This paper See Table S1 GAPDH Reverse: TGTAGACCAGTATGTTGAGGTCA This paper See Table S1 LCN2 Forward: AGCCGTGGTAGATGGCTAGG This paper See Table S1 AXL Forward: ATGGCCGACATTGCCAGTG This paper See Table S1 AXL Reverse: CGGTAGTAATCCCCGTTGTAGA This paper See Table S1 OPCML Forward: CCACCCTCAGGTGTACCATAG This paper See Table S1 OPCML Reverse: GTAGGCGTGTTGACCAAAATGA This paper See Table S1 Gas6 Forward: TGCTGGCTTCCGAGTCTTC This paper See Table S1 Gas6 Reverse: CGGGGTCGTTCTCGAACAC This paper See Table S1 TENC1 Forward: TGAACCACTCAAAGCAACGCA This paper See Table S1 TENC1 Reverse: CGTTACATAGGTGAGGTCCAAGT This paper See Table S1 Recombinant DNA psPAX2 Addgene (Didier Trono) RRID:Addgene_12260; Cat# 12260 pMD2.G Addgene (Didier Trono) RRID:Addgene_12259; Cat# 12259 MISSION pLKO.1-puro Non-Mammalian shRNA Control Sigma TRC #SHC002 Lcn2 shRNA KD1 Sigma TRC #TRCN0000055328 Lcn2 shRNA KD2 Sigma TRC #TRCN0000055331 Lcn2 shRNA KD3 Sigma TRC #TRCN0000055332 Software and algorithms PRISM GraphPad https://www.graphpad.com/ FlowJo v10 BD Biosciences https://www.flowjo.com/ (Continued on next page) Cell Reports 45, 116965, March 24, 2026 17

    SYBR Green Assay:

    Article Title: Lipocalin 2 orchestrates resistance to ferroptosis via AXL.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GPX4 Cell Signaling Technology Cat #52455S; RRID:AB_2924984 Rabbit anti-pAXL (Y702) ThermoFisher Cat #PA5-64862; RRID:AB_2662770 Rabbit anti-AXL (C terminus) LS Bio Cat # LS-B12012-100 hFAB TM Rhodamine Anti-Actin Bio-Rad Cat #120041163 Goat anti-rabbit StarBright Blue 700 Bio-Rad Cat #12004161; RRID:AB_2721073 Rabbit anti-BCL-XL Cell Signaling Technology Cat #2764T; RRID:AB_2228008 Rabbit anti-BIM Cell Signaling Technology Cat #2819S; RRID:AB_10692515 Rabbit anti-BAK Cell Signaling Technology Cat #3814S; RRID:AB_2290287 Rabbit anti-lipocalin-2 antibody Abcam Cat #ab63929; RRID:AB_1140965 Chicken anti-GFP Aves Labs Cat #GFP-1020; RRID:AB_10000240 Mouse anti-Beta III Tubulin Promega Cat #G7121; RRID:AB_430874 Rabbit anti-Phosphorylated Histone H3 Cell Signaling Technology Cat #4499; RRID:AB_10544537 Rabbit anti-Cleaved Caspase 3 Cell Signaling Technology Cat #9661; RRID:AB_2341188 Bacterial and virus strains psPAX2 (lentiviral packaging plasmid) Addgene (Didier Trono) Cat #12260; RRID:Addgene_12260 pMD2.G (lentiviral packaging plasmid) Addgene (Didier Trono) Cat #12259; RRID:Addgene_12259 MISSION pLKO.1-puro Non-Mammalian shRNA Control Sigma TRC #SHC002 Lcn2 shRNA KD1 Sigma TRC #TRCN0000055328 Lcn2 shRNA KD2 Sigma TRC #TRCN0000055331 Lcn2 shRNA KD3 Sigma TRC #TRCN0000055332 Biological samples Human glioblastoma patient tissue This paper, Cleveland Clinic See STAR Methods Human non-tumor patient tissue This paper, Cleveland Clinic See STAR Methods Primary mouse astrocytes Silver et al. 80 See STAR Methods Chemicals, peptides, and recombinant proteins RPMI 1640 medium Cleveland Clinic Media Preparation Core N/A Fetal bovine serum Cleveland Clinic Media Preparation Core N/A Penicillin-Streptomycin Cleveland Clinic Media Preparation Core N/A Trypsin-EDTA Cleveland Clinic Media Preparation Core N/A Trypan Blue ThermoFisher Cat #15250061 Image-It Lipid Peroxidation Kit Invitrogen Cat #C10445 CellRox Deep Red ThermoFisher Cat #C10422 Deferoxamine (DFO) Sigma Cat #D9533-1G RSL3 (GPX4 inhibitor) SelleckChem Cat #S8155 Erastin SelleckChem Cat #S7242 Ferrostatin-1 (Fer-1) SelleckChem Cat #S7243 Liproxstatin-1 (Lip-1) SelleckChem Cat #S7699 Necrostatin-1 SelleckChem Cat #ab141053 Z-VAD-FMK InvivoGen Cat #tlrl-vad PAC-1 SelleckChem Cat #S2738 Bemcentinib (R428, BGB324) SelleckChem Cat #S2841 1x NP-40 lysis buffer ThermoFisher Cat #J60766.AP Protease inhibitor cocktail Sigma-Aldrich Cat #P8340 (Continued on next page) 16 Cell Reports 45, 116965, March 24, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Phosphatase inhibitor cocktail Sigma-Aldrich Cat #P5725 PMSF Sigma-Aldrich Cat #10837091001 Sodium acetate ThermoFisher Cat #A13184-30 Thioglycolic acid Fisher Scientific Cat #M0052252G Chromogenic solution (FerroZine) MedChemExpress Cat #HY-137805 FITC-annexin V BioLegend Cat #640914 DRAQ7 ThermoFisher Cat #D15105 Critical commercial assays CellTiter Glo Cell Viability Assay Promega Cat #G7573 RNeasy Mini Kit Qiagen Cat #74106 qScript cDNA SuperMix Quanta Biosciences Cat #95048-100 Fast SYBR Green Mastermix ThermoFisher Cat #4385618 Proteome Profiler Mouse Phospho-RTK Array Kit R&D Systems CatARY014 Experimental models: Cell lines OL61 (mouse glioma) Castro-Lowenstein Laboratory, Univ. .. Michigan See STAR Methods KR158 (mouse glioma) Deleyrolle Laboratory, Mayo Clinic See STAR Methods CPA (mouse glioma) Deleyrolle Laboratory, Mayo Clinic See STAR Methods Experimental models: Organisms/strains C57BL/6 JAX RRID:IMSR_JAX:000664 NOD.Cg-Prkdc scid Il2rg tm1Wjl /SzJ Biological Resources Unit, Lerner Research Institute; Cleveland Clinic – B6.129P2-Lcn2 tm1Aade /AkiJ KAX RRID:IMSR_JAX:024630 Oligonucleotides LCN2 Forward: AGCCGTGGTAGATGGCTAGG This paper See Table S1 LCN2 Reverse: TTCCGCGGGTGACAGGGCTTC This paper See Table S1 GAPDH Forward: AGGCTGGTGACGAGGATTTG This paper See Table S1 GAPDH Reverse: TGTAGACCAGTATGTTGAGGTCA This paper See Table S1 LCN2 Forward: AGCCGTGGTAGATGGCTAGG This paper See Table S1 AXL Forward: ATGGCCGACATTGCCAGTG This paper See Table S1 AXL Reverse: CGGTAGTAATCCCCGTTGTAGA This paper See Table S1 OPCML Forward: CCACCCTCAGGTGTACCATAG This paper See Table S1 OPCML Reverse: GTAGGCGTGTTGACCAAAATGA This paper See Table S1 Gas6 Forward: TGCTGGCTTCCGAGTCTTC This paper See Table S1 Gas6 Reverse: CGGGGTCGTTCTCGAACAC This paper See Table S1 TENC1 Forward: TGAACCACTCAAAGCAACGCA This paper See Table S1 TENC1 Reverse: CGTTACATAGGTGAGGTCCAAGT This paper See Table S1 Recombinant DNA psPAX2 Addgene (Didier Trono) RRID:Addgene_12260; Cat# 12260 pMD2.G Addgene (Didier Trono) RRID:Addgene_12259; Cat# 12259 MISSION pLKO.1-puro Non-Mammalian shRNA Control Sigma TRC #SHC002 Lcn2 shRNA KD1 Sigma TRC #TRCN0000055328 Lcn2 shRNA KD2 Sigma TRC #TRCN0000055331 Lcn2 shRNA KD3 Sigma TRC #TRCN0000055332 Software and algorithms PRISM GraphPad https://www.graphpad.com/ FlowJo v10 BD Biosciences https://www.flowjo.com/ (Continued on next page) Cell Reports 45, 116965, March 24, 2026 17



    Similar Products

    proteome profiler mouse phospho rtk array kit r d systems cat  (R&D Systems)
    94
    R&D Systems proteome profiler mouse phospho rtk array kit r d systems cat
    Proteome Profiler Mouse Phospho Rtk Array Kit R D Systems Cat, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/proteome+profiler+mouse+phospho+rtk+array+kit+r+d+systems+cat/Proteome+Profiler+Mouse+Phospho-RTK+Array+Kit/pm41762656-249-72-78
    Average 94 stars, based on 1 article reviews
    proteome profiler mouse phospho rtk array kit r d systems cat - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier

    Image Search Results